ID: 1128055907_1128055915

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1128055907 1128055915
Species Human (GRCh38) Human (GRCh38)
Location 15:64700035-64700057 15:64700066-64700088
Sequence CCCAGGCCAAGTGGAGGAGCCTG CCTAGCTCCTACCCAGGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 273} {0: 1, 1: 0, 2: 3, 3: 36, 4: 381}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!