ID: 1128064498_1128064502

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1128064498 1128064502
Species Human (GRCh38) Human (GRCh38)
Location 15:64755900-64755922 15:64755916-64755938
Sequence CCTTCCTCACTCCTTAACTAAAG ACTAAAGGTATCCAGCCTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 206} {0: 1, 1: 0, 2: 1, 3: 3, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!