ID: 1128065889_1128065894

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1128065889 1128065894
Species Human (GRCh38) Human (GRCh38)
Location 15:64764182-64764204 15:64764228-64764250
Sequence CCTGCAGCCTTCTTGGTGCTGTG GCCTGCCTGTGTGCCTGGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 348} {0: 1, 1: 0, 2: 7, 3: 67, 4: 527}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!