ID: 1128074264_1128074279

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1128074264 1128074279
Species Human (GRCh38) Human (GRCh38)
Location 15:64816530-64816552 15:64816583-64816605
Sequence CCCTGCCCGTGGCCACAGCCCAC GCTCCTGCCCCGCCGCAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 365} {0: 1, 1: 0, 2: 1, 3: 22, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!