ID: 1128090817_1128090820

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1128090817 1128090820
Species Human (GRCh38) Human (GRCh38)
Location 15:64917493-64917515 15:64917526-64917548
Sequence CCTCACAGAGGCACGTCTGTGTG TCTGTCTGTCTGTCTCAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 166} {0: 1, 1: 1, 2: 6, 3: 73, 4: 520}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!