ID: 1128106305_1128106312

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1128106305 1128106312
Species Human (GRCh38) Human (GRCh38)
Location 15:65047842-65047864 15:65047889-65047911
Sequence CCCTCAAATGAGTAAGTAGGCAG TAAGAAAGGGCCAGGCACGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 100} {0: 1, 1: 25, 2: 226, 3: 1898, 4: 9303}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!