ID: 1128107984_1128107993

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1128107984 1128107993
Species Human (GRCh38) Human (GRCh38)
Location 15:65058443-65058465 15:65058494-65058516
Sequence CCAGCTTGTTGCCCAGCAGCAGG CGTGCAAGGCAAGCAGCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 266} {0: 1, 1: 0, 2: 1, 3: 3, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!