ID: 1128109538_1128109550

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1128109538 1128109550
Species Human (GRCh38) Human (GRCh38)
Location 15:65067895-65067917 15:65067936-65067958
Sequence CCCGTCGGGGCCCAGGGGAGCGG GCGCGCGGCCCCGGACCCGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 201} {0: 1, 1: 0, 2: 1, 3: 10, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!