ID: 1128111300_1128111304

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1128111300 1128111304
Species Human (GRCh38) Human (GRCh38)
Location 15:65077768-65077790 15:65077793-65077815
Sequence CCGCCGTGGTGGAGTACGCAGTG GACCGACGCGTGGCTGCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 224} {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!