ID: 1128138233_1128138236

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1128138233 1128138236
Species Human (GRCh38) Human (GRCh38)
Location 15:65280131-65280153 15:65280144-65280166
Sequence CCTTCCTTAGAAAGGTTAGCCAT GGTTAGCCATGAGCCAGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98} {0: 1, 1: 0, 2: 1, 3: 21, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!