ID: 1128138233_1128138242

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1128138233 1128138242
Species Human (GRCh38) Human (GRCh38)
Location 15:65280131-65280153 15:65280178-65280200
Sequence CCTTCCTTAGAAAGGTTAGCCAT TGTAATCCCAGCATTTTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98} {0: 604, 1: 24329, 2: 323900, 3: 265228, 4: 199769}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!