ID: 1128151754_1128151761

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1128151754 1128151761
Species Human (GRCh38) Human (GRCh38)
Location 15:65367621-65367643 15:65367638-65367660
Sequence CCCGCCACCCGCTGGCCACTCTC ACTCTCCACCCAGTGTCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 400} {0: 1, 1: 0, 2: 1, 3: 17, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!