ID: 1128156908_1128156918

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1128156908 1128156918
Species Human (GRCh38) Human (GRCh38)
Location 15:65396817-65396839 15:65396859-65396881
Sequence CCTTCGGCCCGCCTCACCCAGCA AGTGGCGAAGTCGCGCGTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 225} {0: 1, 1: 0, 2: 0, 3: 0, 4: 17}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!