ID: 1128157756_1128157762

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1128157756 1128157762
Species Human (GRCh38) Human (GRCh38)
Location 15:65402411-65402433 15:65402451-65402473
Sequence CCACGCAGCGGTAGGGGCCTGCA CAGGATCTGAAGGACGCCGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67} {0: 1, 1: 0, 2: 0, 3: 5, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!