ID: 1128161031_1128161051

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1128161031 1128161051
Species Human (GRCh38) Human (GRCh38)
Location 15:65422950-65422972 15:65422993-65423015
Sequence CCCGGGGAGGCGCGGCGCCGCGG GCCCGGGCCCGAGCTGGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 52, 4: 326} {0: 1, 1: 1, 2: 10, 3: 76, 4: 867}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!