ID: 1128182884_1128182888

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1128182884 1128182888
Species Human (GRCh38) Human (GRCh38)
Location 15:65620560-65620582 15:65620593-65620615
Sequence CCTGCTGAATTTCAAAATGTGCC GATAATAAGACAGAAGAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 189} {0: 1, 1: 0, 2: 2, 3: 42, 4: 555}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!