ID: 1128182885_1128182890

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1128182885 1128182890
Species Human (GRCh38) Human (GRCh38)
Location 15:65620581-65620603 15:65620608-65620630
Sequence CCAGAATCCCATGATAATAAGAC GAAACTGGGTTTACCCCCAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 109} {0: 1, 1: 0, 2: 0, 3: 10, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!