ID: 1128182886_1128182890

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1128182886 1128182890
Species Human (GRCh38) Human (GRCh38)
Location 15:65620588-65620610 15:65620608-65620630
Sequence CCCATGATAATAAGACAGAAGAA GAAACTGGGTTTACCCCCAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 875, 4: 2185} {0: 1, 1: 0, 2: 0, 3: 10, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!