ID: 1128185961_1128185973

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1128185961 1128185973
Species Human (GRCh38) Human (GRCh38)
Location 15:65643735-65643757 15:65643778-65643800
Sequence CCTCCAGCAAAGCATGTGCATAG TCGGGCTCTTGTTGTGCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 143} {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!