ID: 1128232102_1128232109

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1128232102 1128232109
Species Human (GRCh38) Human (GRCh38)
Location 15:66042658-66042680 15:66042685-66042707
Sequence CCCCCTGAAACCTGTTAGGGCAG TCCTCGCCCCTCCCAGCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 125} {0: 1, 1: 3, 2: 45, 3: 322, 4: 1227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!