ID: 1128241987_1128241998

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1128241987 1128241998
Species Human (GRCh38) Human (GRCh38)
Location 15:66107553-66107575 15:66107584-66107606
Sequence CCCCACAGAGCCCCAGAGCAGGG CTCTTCACACACATGGGACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 50, 4: 443} {0: 1, 1: 0, 2: 2, 3: 15, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!