ID: 1128250883_1128250895

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1128250883 1128250895
Species Human (GRCh38) Human (GRCh38)
Location 15:66163682-66163704 15:66163707-66163729
Sequence CCCCTGAGGATTTACAGCCTCCC CTGAGTTATGGGAAGGCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 137} {0: 1, 1: 0, 2: 0, 3: 13, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!