ID: 1128252071_1128252080

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1128252071 1128252080
Species Human (GRCh38) Human (GRCh38)
Location 15:66170780-66170802 15:66170810-66170832
Sequence CCCTCCCCACAAGCACGGCCCTC TGCAGCCCCTGTCCAGGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 265} {0: 1, 1: 1, 2: 3, 3: 29, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!