ID: 1128264120_1128264137

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1128264120 1128264137
Species Human (GRCh38) Human (GRCh38)
Location 15:66253102-66253124 15:66253149-66253171
Sequence CCGGCCGCCGCCGAAAACCTGCT GACCCCGGCGGGGAAGGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 47} {0: 1, 1: 0, 2: 1, 3: 24, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!