ID: 1128291721_1128291729

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1128291721 1128291729
Species Human (GRCh38) Human (GRCh38)
Location 15:66483237-66483259 15:66483261-66483283
Sequence CCTACCCCCCACTGTGACTCCAG CACTGTCAACATCACTCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 348} {0: 1, 1: 1, 2: 5, 3: 21, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!