ID: 1128313567_1128313581

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1128313567 1128313581
Species Human (GRCh38) Human (GRCh38)
Location 15:66646438-66646460 15:66646490-66646512
Sequence CCCTGGGATAGTGGTCAGTGCGT AGGCTGAAGCCAGCTGGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50} {0: 1, 1: 0, 2: 9, 3: 72, 4: 550}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!