ID: 1128314502_1128314508

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1128314502 1128314508
Species Human (GRCh38) Human (GRCh38)
Location 15:66652182-66652204 15:66652206-66652228
Sequence CCCTCTCTGGGCCTCAGTTTCCC ATCTGTCAATGAGTTAGACCAGG
Strand - +
Off-target summary {0: 95, 1: 356, 2: 997, 3: 2066, 4: 3630} {0: 1, 1: 0, 2: 0, 3: 7, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!