ID: 1128322543_1128322557

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1128322543 1128322557
Species Human (GRCh38) Human (GRCh38)
Location 15:66703442-66703464 15:66703477-66703499
Sequence CCGGTAGCCCCGCGGCGGCCCCG ACAGCGAGGCGCCCAGGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 21, 4: 236} {0: 1, 1: 0, 2: 0, 3: 13, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!