ID: 1128367855_1128367859

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1128367855 1128367859
Species Human (GRCh38) Human (GRCh38)
Location 15:67017353-67017375 15:67017395-67017417
Sequence CCAGCCTGGGCAACAATAGCAAA GAAAAAAGAAAAGATGCAGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!