ID: 1128376045_1128376054

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1128376045 1128376054
Species Human (GRCh38) Human (GRCh38)
Location 15:67076767-67076789 15:67076815-67076837
Sequence CCTGCATCAGTGTCTTGAGCCTG CCCCAGGTCTGTTTTACTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 228} {0: 1, 1: 0, 2: 0, 3: 13, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!