ID: 1128376593_1128376600

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1128376593 1128376600
Species Human (GRCh38) Human (GRCh38)
Location 15:67080894-67080916 15:67080913-67080935
Sequence CCTTCTCTTGCCCCAGATAATTT ATTTATTGGAAGTCTGGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 323} {0: 1, 1: 1, 2: 2, 3: 24, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!