ID: 1128376648_1128376652

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1128376648 1128376652
Species Human (GRCh38) Human (GRCh38)
Location 15:67081281-67081303 15:67081299-67081321
Sequence CCTGGTGTCATGGGGATGACTAG ACTAGGCCATCTTGTGGGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 153} {0: 1, 1: 0, 2: 0, 3: 6, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!