ID: 1128438304_1128438308

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1128438304 1128438308
Species Human (GRCh38) Human (GRCh38)
Location 15:67677916-67677938 15:67677949-67677971
Sequence CCAGGCAATAACTGCCATTGAGG ATGCTGTTTAATTTTATTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 79} {0: 1, 1: 0, 2: 4, 3: 93, 4: 1108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!