ID: 1128438847_1128438855

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1128438847 1128438855
Species Human (GRCh38) Human (GRCh38)
Location 15:67683636-67683658 15:67683674-67683696
Sequence CCTGTAATCCTAGCTACTCAGGA AGCTTGAACCTGGGCATTGGAGG
Strand - +
Off-target summary {0: 2479, 1: 61175, 2: 150793, 3: 234901, 4: 202389} {0: 1, 1: 4, 2: 82, 3: 1831, 4: 21497}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!