|
Left Crispr |
Right Crispr |
| Crispr ID |
1128438849 |
1128438855 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:67683644-67683666
|
15:67683674-67683696
|
| Sequence |
CCTAGCTACTCAGGAGGCTGAGG |
AGCTTGAACCTGGGCATTGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 96881, 1: 202886, 2: 238913, 3: 154169, 4: 85070} |
{0: 1, 1: 4, 2: 82, 3: 1831, 4: 21497} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|