ID: 1128467707_1128467713

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1128467707 1128467713
Species Human (GRCh38) Human (GRCh38)
Location 15:67926752-67926774 15:67926792-67926814
Sequence CCATATGACCACATTCTCTCCAG AATGACATGTGGCATTTAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 677} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!