ID: 1128482767_1128482788

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1128482767 1128482788
Species Human (GRCh38) Human (GRCh38)
Location 15:68054386-68054408 15:68054439-68054461
Sequence CCGCGGAGACGGCGCCGCTGCTG CTCTCGGGCCTGACTCCACCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 170} {0: 1, 1: 0, 2: 0, 3: 13, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!