ID: 1128496126_1128496134

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1128496126 1128496134
Species Human (GRCh38) Human (GRCh38)
Location 15:68199639-68199661 15:68199678-68199700
Sequence CCCCTCTGCTGCTTGTCATACAG TACTCTGCACACGGCCCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 279} {0: 1, 1: 0, 2: 0, 3: 10, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!