ID: 1128501644_1128501651

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1128501644 1128501651
Species Human (GRCh38) Human (GRCh38)
Location 15:68230896-68230918 15:68230945-68230967
Sequence CCAGGCGCACACGACATGTGCAG AGCCCTCAAGCCGCTGCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 52} {0: 1, 1: 0, 2: 0, 3: 15, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!