ID: 1128508861_1128508872

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1128508861 1128508872
Species Human (GRCh38) Human (GRCh38)
Location 15:68301414-68301436 15:68301467-68301489
Sequence CCAAGGGCAGAAGCTACAGTGAA ATAGATGGAAGGGTGATCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 330} {0: 1, 1: 1, 2: 0, 3: 12, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!