ID: 1128519132_1128519138

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1128519132 1128519138
Species Human (GRCh38) Human (GRCh38)
Location 15:68364166-68364188 15:68364213-68364235
Sequence CCAGCCTTCTTCATCTAATCCTG TGTAGCCCTTCCCTCGGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 272} {0: 1, 1: 0, 2: 0, 3: 12, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!