ID: 1128525958_1128525965

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1128525958 1128525965
Species Human (GRCh38) Human (GRCh38)
Location 15:68412428-68412450 15:68412471-68412493
Sequence CCTGAATCACTCAGGGAATGACA CAGGCACCCAACATGGATTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 197} {0: 1, 1: 0, 2: 2, 3: 7, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!