ID: 1128527286_1128527289

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1128527286 1128527289
Species Human (GRCh38) Human (GRCh38)
Location 15:68421287-68421309 15:68421301-68421323
Sequence CCAAGGTGCCTGATGTGTTTGAA GTGTTTGAAGAACAGCCCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 154} {0: 1, 1: 0, 2: 3, 3: 34, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!