ID: 1128547335_1128547338

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1128547335 1128547338
Species Human (GRCh38) Human (GRCh38)
Location 15:68577340-68577362 15:68577353-68577375
Sequence CCTTCTCTAAATCCGTTTACTCA CGTTTACTCATCAGCAAAATGGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 39, 3: 578, 4: 3669}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!