ID: 1128548545_1128548557

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1128548545 1128548557
Species Human (GRCh38) Human (GRCh38)
Location 15:68583398-68583420 15:68583438-68583460
Sequence CCTCGGTCCTGACTCATGGTCAG TGCCCTGGCAAGGGGTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 101} {0: 1, 1: 0, 2: 0, 3: 36, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!