ID: 1128557235_1128557241

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1128557235 1128557241
Species Human (GRCh38) Human (GRCh38)
Location 15:68640085-68640107 15:68640133-68640155
Sequence CCATGCATCTGACCTCACAGTGA CTTCTGCAGACACCCAGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 203} {0: 1, 1: 1, 2: 1, 3: 23, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!