ID: 1128597744_1128597747

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1128597744 1128597747
Species Human (GRCh38) Human (GRCh38)
Location 15:68966837-68966859 15:68966854-68966876
Sequence CCTGTGGATGTCATTACACTTTA ACTTTAGGTGGATCTCTTGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 23, 4: 209} {0: 1, 1: 0, 2: 0, 3: 8, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!