ID: 1128635361_1128635380

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1128635361 1128635380
Species Human (GRCh38) Human (GRCh38)
Location 15:69299117-69299139 15:69299165-69299187
Sequence CCGCCCTCCGCGGCAGCCCCAGC AGCCTGGGTGGCCGCTCCGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 69, 4: 732} {0: 1, 1: 0, 2: 0, 3: 5, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!