ID: 1128643548_1128643559

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1128643548 1128643559
Species Human (GRCh38) Human (GRCh38)
Location 15:69358478-69358500 15:69358525-69358547
Sequence CCGTCCAGGGGCAGCCTCTGGTG CCCTGCTGCGGTGCGGCCTTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 44, 4: 368} {0: 1, 1: 1, 2: 0, 3: 8, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!