ID: 1128649057_1128649067

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1128649057 1128649067
Species Human (GRCh38) Human (GRCh38)
Location 15:69397234-69397256 15:69397285-69397307
Sequence CCCATGGTCAGGAGATGGTGTCC GTCACTTCCATTGGGGTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 446} {0: 1, 1: 0, 2: 0, 3: 18, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!